|
MedChemExpress
recombinant stat1 proteins Recombinant Stat1 Proteins, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pm41763198-307-0-6?v=MedChemExpress Average 94 stars, based on 1 article reviews
recombinant stat1 proteins - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
oas3 cctgattctgctggtgaagcac tcccaggcaaagatggtgagga origene nm 006187 stat1 ggaacttgatggccctaaagga acagagcccactatccgagaca haseley Oas3 Cctgattctgctggtgaagcac Tcccaggcaaagatggtgagga Origene Nm 006187 Stat1 Ggaacttgatggccctaaagga Acagagcccactatccgagaca Haseley, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pm41973907-291-50-53?v=OriGene Average 94 stars, based on 1 article reviews
oas3 cctgattctgctggtgaagcac tcccaggcaaagatggtgagga origene nm 006187 stat1 ggaacttgatggccctaaagga acagagcccactatccgagaca haseley - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
R&D Systems
phosphorylated stat1 ![]() Phosphorylated Stat1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pmc13071079-266-31-33?v=R%26D+Systems Average 92 stars, based on 1 article reviews
phosphorylated stat1 - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti human stat1 ![]() Anti Human Stat1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pmc13036235-193-18-21?v=Cell+Signaling+Technology+Inc Average 97 stars, based on 1 article reviews
anti human stat1 - by Bioz Stars,
2026-07
97/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti human phospho stat1 ![]() Anti Human Phospho Stat1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pmc13036235-193-24-27?v=Cell+Signaling+Technology+Inc Average 97 stars, based on 1 article reviews
anti human phospho stat1 - by Bioz Stars,
2026-07
97/100 stars
|
Buy from Supplier |
|
MedChemExpress
d8375 recombinant stat1 protein mce hy p73628 ![]() D8375 Recombinant Stat1 Protein Mce Hy P73628, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pm41763198-212-238-242?v=MedChemExpress Average 94 stars, based on 1 article reviews
d8375 recombinant stat1 protein mce hy p73628 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
human mouse phospho stat1 tyr701 ![]() Human Mouse Phospho Stat1 Tyr701, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/pmc12963926-334-9-6?v=Cell+Signaling+Technology+Inc Average 93 stars, based on 1 article reviews
human mouse phospho stat1 tyr701 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti human stat1 ![]() Rabbit Anti Human Stat1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/bio_rxiv__64898__2025__12__08__692940-91-4-32?v=Cell+Signaling+Technology+Inc Average 86 stars, based on 1 article reviews
rabbit anti human stat1 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
rabbit anti human phosphorylated stat1 ![]() Rabbit Anti Human Phosphorylated Stat1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/human+stat1/bio_rxiv__64898__2025__12__08__692940-91-14-32?v=Cell+Signaling+Technology+Inc Average 86 stars, based on 1 article reviews
rabbit anti human phosphorylated stat1 - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
Journal: Signal Transduction and Targeted Therapy
Article Title: Bioengineered iPSC-derived human macrophages with increased angiotensin-converting enzyme (ACE) expression suppress solid tumor growth
doi: 10.1038/s41392-026-02650-3
Figure Lengend Snippet: Determination of M1 vs. M2 polarization in iMac. a Pro-inflammatory M1 cytokines IL-1β, TNFα, IL-6, and IL-8 measured by ELISA. b Anti-inflammatory M2 cytokines IL-4, IL-10, IL-13, CCL5, CCL17, and CCL20 measured by ELISA. For a , b iMac were cultured in 6-well plates (3 × 10 6 cells/well). To challenge with tumor factors, iMac were co-cultured with 50% fresh supernatant from SK-MEL-28 cells every 24 h for 3 days. Supernatants were collected during the final 24 h for cytokine measurement. c Activation (phosphorylation) of NF-kB p65, STAT1, STAT3, and STAT6 in iMac was determined using Western blotting after conditioning with melanoma (SK-MEL-28) supernatant for 72 h. Protein band intensity was quantified using Odyssey version 3.0 software. After adjusting for loading using the β-actin band, data are presented as fold change to the iMac (Dox-) group, which is set as 1. For a – c , one-way ANOVA with Bonferroni’s correction for multiple comparisons was used to analyze group comparisons. Data are presented as means ± SD. Each experiment was performed three times, with triplicate samples each time. * p < 0.05, *** p < 0.001, and **** p < 0.0001
Article Snippet: The polyvinylidene difluoride (PVDF) membranes were incubated with specific primary antibodies against ACE (R&D Systems, MAB9291, 1:1,000), GAPDH (Sigma-Aldrich, SAB5600208, 1:2,000), β-actin (Sigma-Aldrich, A3854; 1:1000), phosphorylated NF-kB p65 (Novus, NB100-82086, 1:500),
Techniques: Enzyme-linked Immunosorbent Assay, Cell Culture, Activation Assay, Phospho-proteomics, Western Blot, Software
Journal: Frontiers in Immunology
Article Title: IFNγ-induced antigen loss in chimeric antigen receptor-T cell therapy
doi: 10.3389/fimmu.2026.1772472
Figure Lengend Snippet: CART-induced GUCY2C loss is mediated by the IFNγ-JAK-STAT1 signaling axis. (A) LS174T cells and orthogonal approaches of cytokine screening (B) and confirmation (C) , IFNγ neutralizing antibody (D) , pharmacologic JAK1/2 blockade with ruxolitinib (E) , and JAK1/2 genetic knockout (F) were used to define the role of the IFNγ-JAK-STAT signaling axis in GUCY2C loss. (B) LS174T cells were treated with GM-CSF (20 ng/mL), TNFα (1 ng/mL), IL-8 (2 ng/mL), MIP-1α (2 ng/mL), MIP-1β (2 ng/mL), or IFNγ (15 ng/mL) for 48 hours, and GUCY2C protein levels were quantified. (C) LS174T cells were treated with 150 ng/mL IFNγ for 48 hours, and pSTAT1 and GUCY2C protein levels were quantified. (D–F) LS174T cells were treated with conditioned media (CM) for 48 hours from control or anti-CD3/CD2/CD28 bead-activated T cells, and pSTAT1 and GUCY2C protein levels were quantified; (D) 13 μg/mL anti-IFNγ neutralizing antibody was included in some conditions; (E) 2.5 μM ruxolitinib was included in some conditions; (F) LS174T cell pools previously treated with control CRISPR/Cas9 or JAK1 + 2 CRISPR/Cas9 were used. Each data point in (B–F) represents average of biological replicates from separate experiments (N = 3–4 experiments). In (C–F) , pSTAT, GUCY2C, and housekeeping control were examined on the same blot. The housekeeping protein is shown only below GUCY2C. A paired t-test was used to compare the two conditions in (C) ; in (B) and (D–F) , one-way ANOVA was used to compare each condition to the control treatment, and additional comparisons are indicated by bars; ns = p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Figure schematics were generated using BioRender.com .
Article Snippet: Membranes were probed using an anti-human GUCY2C antibody (37517, Cell Signaling Technology), anti-human GAPDH (2118S, Cell Signaling Technology),
Techniques: Knock-Out, Control, CRISPR, Generated
Journal: bioRxiv
Article Title: IFN-I exacerbates the inflammatory response of epithelial cells to Chlamydia trachomatis infection by enhancing TLR3 expression
doi: 10.64898/2025.12.08.692940
Figure Lengend Snippet: PI3K/AKT-mTOR but not STAT1 signaling pathways downstream of IFN-I are implicated in the synergy between IFN-I and C. trachomatis . (A) HeLa cells were incubated with IFNβ and/or C. trachomatis for 24 h followed by the detection of activation and expression of STAT1 via immunoblot. The results are representatives of three independent experiments. (B) siRNA against STAT1 or irrelevant oligonucleotides were transfected into HeLa cells for 24 h prior to incubation with IFNβ alone (left graph) or with IFNβ and C. trachomatis (right graph). The transcriptional level of STAT1 (left graph) was measured by real-time RT-qPCR and normalized to actin transcript following the 2 -ΔΔCt method. The data are presented as relative mRNA levels compared to untreated cells and shown as the mean±SE with individual values of three experiments. P-value of Student’s unpaired t-test is shown (* for p < 0.05). Intracellular IL6 protein (right panel) was determined by flow cytometry using anti-human IL6-PC7 antibody. The results of four independent experiments are shown. C-D) HeLa cells were pre-incubated with wortmannin (5 μM) (C) or SB203580 (10 μM) (D) for 1 h. Cells were then treated with IFNβ and/or C. trachomatis for 24 h in the presence of these inhibitors prior to brefeldin A addition for 6 h. Intracellular IL6 expression was analyzed by flow cytometry using anti-human IL6-PC7 antibody. The histograms are the representatives of two (C) or four experiments (D), respectively. The results of the four independent experiments are shown as a violin plot in (D), with p-value of a Student’s unpaired t-test (* for p< 0.05). (E) Same as in D using mTOR inhibitors, rapamycin and torin1 (1 μM). The results of five independent experiments and p-value of a Student’s unpaired t-test are shown (* for p< 0.05). (F) HeLa cells were treated with pharmacological inhibitors (upper panels) or transfected with siRNA (lower panel) as described above, followed by IFNβ and/or C. trachomatis treatment for 24 h. TLR3 transcripts was measured by rea-time RT-qPCR as above. Data from three independent experiments and p-values of Student’s unpaired t-test are shown (* p< 0.05, ** p<0.01, *** p<0.001 and **** p<0.0001). (G) The cells were incubated with SB203580 (10 μM) for 1 h before addition of IFNβ for 30 min. Phosphorylation of mTOR, AKT and p38 was detected by immunoblot. The results are representatives of three independent experiments.
Article Snippet: Primary antibodies used were
Techniques: Protein-Protein interactions, Incubation, Activation Assay, Expressing, Western Blot, Transfection, Quantitative RT-PCR, Flow Cytometry, Phospho-proteomics
Journal: bioRxiv
Article Title: IFN-I exacerbates the inflammatory response of epithelial cells to Chlamydia trachomatis infection by enhancing TLR3 expression
doi: 10.64898/2025.12.08.692940
Figure Lengend Snippet: PI3K/AKT-mTOR but not STAT1 signaling pathways downstream of IFN-I are implicated in the synergy between IFN-I and C. trachomatis . (A) HeLa cells were incubated with IFNβ and/or C. trachomatis for 24 h followed by the detection of activation and expression of STAT1 via immunoblot. The results are representatives of three independent experiments. (B) siRNA against STAT1 or irrelevant oligonucleotides were transfected into HeLa cells for 24 h prior to incubation with IFNβ alone (left graph) or with IFNβ and C. trachomatis (right graph). The transcriptional level of STAT1 (left graph) was measured by real-time RT-qPCR and normalized to actin transcript following the 2 -ΔΔCt method. The data are presented as relative mRNA levels compared to untreated cells and shown as the mean±SE with individual values of three experiments. P-value of Student’s unpaired t-test is shown (* for p < 0.05). Intracellular IL6 protein (right panel) was determined by flow cytometry using anti-human IL6-PC7 antibody. The results of four independent experiments are shown. C-D) HeLa cells were pre-incubated with wortmannin (5 μM) (C) or SB203580 (10 μM) (D) for 1 h. Cells were then treated with IFNβ and/or C. trachomatis for 24 h in the presence of these inhibitors prior to brefeldin A addition for 6 h. Intracellular IL6 expression was analyzed by flow cytometry using anti-human IL6-PC7 antibody. The histograms are the representatives of two (C) or four experiments (D), respectively. The results of the four independent experiments are shown as a violin plot in (D), with p-value of a Student’s unpaired t-test (* for p< 0.05). (E) Same as in D using mTOR inhibitors, rapamycin and torin1 (1 μM). The results of five independent experiments and p-value of a Student’s unpaired t-test are shown (* for p< 0.05). (F) HeLa cells were treated with pharmacological inhibitors (upper panels) or transfected with siRNA (lower panel) as described above, followed by IFNβ and/or C. trachomatis treatment for 24 h. TLR3 transcripts was measured by rea-time RT-qPCR as above. Data from three independent experiments and p-values of Student’s unpaired t-test are shown (* p< 0.05, ** p<0.01, *** p<0.001 and **** p<0.0001). (G) The cells were incubated with SB203580 (10 μM) for 1 h before addition of IFNβ for 30 min. Phosphorylation of mTOR, AKT and p38 was detected by immunoblot. The results are representatives of three independent experiments.
Article Snippet: Primary antibodies used were rabbit anti-human STAT1 (#9172), Erk (#4695), p38 (#9212), AKT (#9272),
Techniques: Protein-Protein interactions, Incubation, Activation Assay, Expressing, Western Blot, Transfection, Quantitative RT-PCR, Flow Cytometry, Phospho-proteomics